aav5 gfp Search Results


95
Vector Biolabs construct termed aav5 u6 shfign cmv gfp
Construct Termed Aav5 U6 Shfign Cmv Gfp, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/aav5+gfp/AAV5-GFP-U6-shRNA/pmc06507085-401-6-17
Average 95 stars, based on 1 article reviews
construct termed aav5 u6 shfign cmv gfp - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

N/A
CV10005 AAV5 Control GFP, 100ul
  Buy from Supplier

95
Vector Biolabs control virus aav5 gfp u6 scrmb shrna caacaagatgaagagcaccaa
Control Virus Aav5 Gfp U6 Scrmb Shrna Caacaagatgaagagcaccaa, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/aav5+gfp/AAV5-GFP/10__1523_slash_jneurosci__0406___21__2021-79-11-17
Average 95 stars, based on 1 article reviews
control virus aav5 gfp u6 scrmb shrna caacaagatgaagagcaccaa - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

90
Vector Biolabs aav cre gfp virus
Aav Cre Gfp Virus, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/aav5+gfp/AAV5-Cre-GFP/10__1164_slash_rccm__201910___1958oc-448-22-24
Average 90 stars, based on 1 article reviews
aav cre gfp virus - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

95
Vector Biolabs virus core gvvc aav 95 aav5 cag
Virus Core Gvvc Aav 95 Aav5 Cag, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/aav5+gfp/AAV5-CAG-GFP/pm36049479-176-19-38
Average 95 stars, based on 1 article reviews
virus core gvvc aav 95 aav5 cag - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

90
VectorBuilder GmbH aav5-dusp6
<t>AAV5-mediated</t> overexpression of <t>DUSP6</t> in dorsal hippocampus (dHc) of 5-month-old 5xFAD and WT mice. (A) Boxplot shows expression of hippocampal DUSP4 mRNA [Log 2 (counts per million reads)] in AD postmortem brain samples from the Mount Sinai Brain Bank (MSBB) stratified by CDR; r , Spearman’s correlation coefficient. (B) Boxplots compare the expression of hippocampal Dusp6 mRNA among female and male 5xFAD and WT mice at different ages using RNAseq data obtained from the AMP-AD portal (see Supplementary Methods). (C) RT-PCR and (D) western blot analyses of DUSP6 overexpression in 5xFAD and WT, n = 9-10 mice/group. (E) Graph shows percentage of colocalization using Mander’s correlation coefficient, and the thresholded Mander’s M values corresponding to the fraction of DUSP6 in NeuN (neurons), IBA1 (microglia), or GFAP (astrocytes) analyzed by the JACoP plugin from ImageJ, n = 6-9 mice/group. (F) Co-staining NeuN (left), GFAP (middle), or IBA1 (right) with DAPI and DUSP6 in hippocampi of 5xFAD and WT mice. (G) RNA scope images of IBA1 protein and Dusp6 mRNA. Scale bars = 20 µm, 50 µm, or 200 µm. Error bars represent means ± SEM. Statistical analyses were performed using a one-way ANOVA followed by a Tukey’s post-hoc test, *p<0.05, **p<0.01, ****p<0.0001.
Aav5 Dusp6, supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/aav5+gfp/aav5+gfp/bio_rxiv__2023__08__24__554335-40-3-4
Average 90 stars, based on 1 article reviews
aav5-dusp6 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
SignaGen aav5 carrying tpa
<t>AAV5-mediated</t> overexpression of <t>DUSP6</t> in dorsal hippocampus (dHc) of 5-month-old 5xFAD and WT mice. (A) Boxplot shows expression of hippocampal DUSP4 mRNA [Log 2 (counts per million reads)] in AD postmortem brain samples from the Mount Sinai Brain Bank (MSBB) stratified by CDR; r , Spearman’s correlation coefficient. (B) Boxplots compare the expression of hippocampal Dusp6 mRNA among female and male 5xFAD and WT mice at different ages using RNAseq data obtained from the AMP-AD portal (see Supplementary Methods). (C) RT-PCR and (D) western blot analyses of DUSP6 overexpression in 5xFAD and WT, n = 9-10 mice/group. (E) Graph shows percentage of colocalization using Mander’s correlation coefficient, and the thresholded Mander’s M values corresponding to the fraction of DUSP6 in NeuN (neurons), IBA1 (microglia), or GFAP (astrocytes) analyzed by the JACoP plugin from ImageJ, n = 6-9 mice/group. (F) Co-staining NeuN (left), GFAP (middle), or IBA1 (right) with DAPI and DUSP6 in hippocampi of 5xFAD and WT mice. (G) RNA scope images of IBA1 protein and Dusp6 mRNA. Scale bars = 20 µm, 50 µm, or 200 µm. Error bars represent means ± SEM. Statistical analyses were performed using a one-way ANOVA followed by a Tukey’s post-hoc test, *p<0.05, **p<0.01, ****p<0.0001.
Aav5 Carrying Tpa, supplied by SignaGen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/aav5+gfp/aav5+cmv+gfp/10__1177_slash_0271678x20901686-41-23-35
Average 90 stars, based on 1 article reviews
aav5 carrying tpa - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
BioFocus DPI aav5-gfp
<t>AAV5-mediated</t> overexpression of <t>DUSP6</t> in dorsal hippocampus (dHc) of 5-month-old 5xFAD and WT mice. (A) Boxplot shows expression of hippocampal DUSP4 mRNA [Log 2 (counts per million reads)] in AD postmortem brain samples from the Mount Sinai Brain Bank (MSBB) stratified by CDR; r , Spearman’s correlation coefficient. (B) Boxplots compare the expression of hippocampal Dusp6 mRNA among female and male 5xFAD and WT mice at different ages using RNAseq data obtained from the AMP-AD portal (see Supplementary Methods). (C) RT-PCR and (D) western blot analyses of DUSP6 overexpression in 5xFAD and WT, n = 9-10 mice/group. (E) Graph shows percentage of colocalization using Mander’s correlation coefficient, and the thresholded Mander’s M values corresponding to the fraction of DUSP6 in NeuN (neurons), IBA1 (microglia), or GFAP (astrocytes) analyzed by the JACoP plugin from ImageJ, n = 6-9 mice/group. (F) Co-staining NeuN (left), GFAP (middle), or IBA1 (right) with DAPI and DUSP6 in hippocampi of 5xFAD and WT mice. (G) RNA scope images of IBA1 protein and Dusp6 mRNA. Scale bars = 20 µm, 50 µm, or 200 µm. Error bars represent means ± SEM. Statistical analyses were performed using a one-way ANOVA followed by a Tukey’s post-hoc test, *p<0.05, **p<0.01, ****p<0.0001.
Aav5 Gfp, supplied by BioFocus DPI, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/aav5+gfp/aav5+gfp/pm31768670-50-2-5
Average 90 stars, based on 1 article reviews
aav5-gfp - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier


Image Search Results


AAV5-mediated overexpression of DUSP6 in dorsal hippocampus (dHc) of 5-month-old 5xFAD and WT mice. (A) Boxplot shows expression of hippocampal DUSP4 mRNA [Log 2 (counts per million reads)] in AD postmortem brain samples from the Mount Sinai Brain Bank (MSBB) stratified by CDR; r , Spearman’s correlation coefficient. (B) Boxplots compare the expression of hippocampal Dusp6 mRNA among female and male 5xFAD and WT mice at different ages using RNAseq data obtained from the AMP-AD portal (see Supplementary Methods). (C) RT-PCR and (D) western blot analyses of DUSP6 overexpression in 5xFAD and WT, n = 9-10 mice/group. (E) Graph shows percentage of colocalization using Mander’s correlation coefficient, and the thresholded Mander’s M values corresponding to the fraction of DUSP6 in NeuN (neurons), IBA1 (microglia), or GFAP (astrocytes) analyzed by the JACoP plugin from ImageJ, n = 6-9 mice/group. (F) Co-staining NeuN (left), GFAP (middle), or IBA1 (right) with DAPI and DUSP6 in hippocampi of 5xFAD and WT mice. (G) RNA scope images of IBA1 protein and Dusp6 mRNA. Scale bars = 20 µm, 50 µm, or 200 µm. Error bars represent means ± SEM. Statistical analyses were performed using a one-way ANOVA followed by a Tukey’s post-hoc test, *p<0.05, **p<0.01, ****p<0.0001.

Journal: bioRxiv

Article Title: Dual-specificity protein phosphatase 6 (DUSP6) overexpression reduces amyloid load and improves memory deficits in male 5xFAD mice

doi: 10.1101/2023.08.24.554335

Figure Lengend Snippet: AAV5-mediated overexpression of DUSP6 in dorsal hippocampus (dHc) of 5-month-old 5xFAD and WT mice. (A) Boxplot shows expression of hippocampal DUSP4 mRNA [Log 2 (counts per million reads)] in AD postmortem brain samples from the Mount Sinai Brain Bank (MSBB) stratified by CDR; r , Spearman’s correlation coefficient. (B) Boxplots compare the expression of hippocampal Dusp6 mRNA among female and male 5xFAD and WT mice at different ages using RNAseq data obtained from the AMP-AD portal (see Supplementary Methods). (C) RT-PCR and (D) western blot analyses of DUSP6 overexpression in 5xFAD and WT, n = 9-10 mice/group. (E) Graph shows percentage of colocalization using Mander’s correlation coefficient, and the thresholded Mander’s M values corresponding to the fraction of DUSP6 in NeuN (neurons), IBA1 (microglia), or GFAP (astrocytes) analyzed by the JACoP plugin from ImageJ, n = 6-9 mice/group. (F) Co-staining NeuN (left), GFAP (middle), or IBA1 (right) with DAPI and DUSP6 in hippocampi of 5xFAD and WT mice. (G) RNA scope images of IBA1 protein and Dusp6 mRNA. Scale bars = 20 µm, 50 µm, or 200 µm. Error bars represent means ± SEM. Statistical analyses were performed using a one-way ANOVA followed by a Tukey’s post-hoc test, *p<0.05, **p<0.01, ****p<0.0001.

Article Snippet: AAV5-GFP (control), and AAV5-DUSP6 (VectorBuilder Inc., Chicago, IL; AAV-5’ITR-CAG-mDUSP6-WPRE-BGHpA-3’ITR) (AAV5 serotype/AAV2 genotype) were prepared by the Vector Core at the University of North Carolina at Chapel Hill.

Techniques: Over Expression, Expressing, Reverse Transcription Polymerase Chain Reaction, Western Blot, Staining

Barnes Maze testing of 5xFAD mice overexpressing DUSP6. (A, B) Male and (C, D) female 5xFAD and WT overexpressing DUSP6 or GFP were tested in the Barnes Maze at 5 months of age, n = 6-7 mice/group. Training was performed in a 5-day session with two trials per day, and the time (A, C) spent to enter the hidden tunnel and the percentage of distance traveled in the target quadrant (B, D) were recorded. Error bars represent means ± SEM. Statistical analyses were performed using a Two-Way ANOVA followed by a Tukey’s post-hoc test, *p<0.05, **p<0.01, ***p< 0.001; ns nonsignificant.

Journal: bioRxiv

Article Title: Dual-specificity protein phosphatase 6 (DUSP6) overexpression reduces amyloid load and improves memory deficits in male 5xFAD mice

doi: 10.1101/2023.08.24.554335

Figure Lengend Snippet: Barnes Maze testing of 5xFAD mice overexpressing DUSP6. (A, B) Male and (C, D) female 5xFAD and WT overexpressing DUSP6 or GFP were tested in the Barnes Maze at 5 months of age, n = 6-7 mice/group. Training was performed in a 5-day session with two trials per day, and the time (A, C) spent to enter the hidden tunnel and the percentage of distance traveled in the target quadrant (B, D) were recorded. Error bars represent means ± SEM. Statistical analyses were performed using a Two-Way ANOVA followed by a Tukey’s post-hoc test, *p<0.05, **p<0.01, ***p< 0.001; ns nonsignificant.

Article Snippet: AAV5-GFP (control), and AAV5-DUSP6 (VectorBuilder Inc., Chicago, IL; AAV-5’ITR-CAG-mDUSP6-WPRE-BGHpA-3’ITR) (AAV5 serotype/AAV2 genotype) were prepared by the Vector Core at the University of North Carolina at Chapel Hill.

Techniques:

Immunohistochemistry and ELISA analyses of amyloid plaque load in hippocampi of 5xFAD mice overexpressing DUSP6. (A) Representative images of 6E10 staining in male and female 5xFAD and WT mice overexpressing DUSP6 or GFP at 5 months of age. Arrows indicate amyloid plaques in the hippocampus. Scale bar = 500 µm. (B) Quantification of intensity and number of 6E10-positive plaques in the hippocampi of male and female 5xFAD and WT mice overexpressing DUSP6 or GFP at 5 months of age. n = 4-6 mice per group and per sex with 3 coronal sections per animal. (C) Western blot analysis of human APP proteins (clone 6E10) in hippocampus of female and male 5xFAD and WT overexpressing DUSP6 or GFP. n = 4-6 mice per group. (D) Human Aβ 1-40 and Aβ 1-42 levels were quantified by ELISA in hippocampi of female and male 5xFAD and WT overexpressing DUSP6 or GFP. (E) BACE1 levels in hippocampi of female and male 5xFAD and WT mice overexpressing DUSP6 or GFP were quantified by western blot. n = 5-6 mice per group. Error bars represent means ± SEM. Statistical analyses were performed using a one-way ANOVA followed by a Tukey’s post-hoc test for BACE1 western blots and a Student’s t-test for all other graphs, *p<0.05, **p<0.01, ***p=0.0001, ****p<0.0001; ns = nonsignificant.

Journal: bioRxiv

Article Title: Dual-specificity protein phosphatase 6 (DUSP6) overexpression reduces amyloid load and improves memory deficits in male 5xFAD mice

doi: 10.1101/2023.08.24.554335

Figure Lengend Snippet: Immunohistochemistry and ELISA analyses of amyloid plaque load in hippocampi of 5xFAD mice overexpressing DUSP6. (A) Representative images of 6E10 staining in male and female 5xFAD and WT mice overexpressing DUSP6 or GFP at 5 months of age. Arrows indicate amyloid plaques in the hippocampus. Scale bar = 500 µm. (B) Quantification of intensity and number of 6E10-positive plaques in the hippocampi of male and female 5xFAD and WT mice overexpressing DUSP6 or GFP at 5 months of age. n = 4-6 mice per group and per sex with 3 coronal sections per animal. (C) Western blot analysis of human APP proteins (clone 6E10) in hippocampus of female and male 5xFAD and WT overexpressing DUSP6 or GFP. n = 4-6 mice per group. (D) Human Aβ 1-40 and Aβ 1-42 levels were quantified by ELISA in hippocampi of female and male 5xFAD and WT overexpressing DUSP6 or GFP. (E) BACE1 levels in hippocampi of female and male 5xFAD and WT mice overexpressing DUSP6 or GFP were quantified by western blot. n = 5-6 mice per group. Error bars represent means ± SEM. Statistical analyses were performed using a one-way ANOVA followed by a Tukey’s post-hoc test for BACE1 western blots and a Student’s t-test for all other graphs, *p<0.05, **p<0.01, ***p=0.0001, ****p<0.0001; ns = nonsignificant.

Article Snippet: AAV5-GFP (control), and AAV5-DUSP6 (VectorBuilder Inc., Chicago, IL; AAV-5’ITR-CAG-mDUSP6-WPRE-BGHpA-3’ITR) (AAV5 serotype/AAV2 genotype) were prepared by the Vector Core at the University of North Carolina at Chapel Hill.

Techniques: Immunohistochemistry, Enzyme-linked Immunosorbent Assay, Staining, Western Blot

The effects of DUSP6 overexpression on VGF network-associated genes in 5xFAD and WT mice. (A) Hippocampal Vgf mRNA levels in 5xFAD or WT mice overexpressing DUSP6 compared to control (WT-GFP), n = 5-11 mice per group. (B) Hippocampal Bdnf mRNA levels in 5xFAD or WT mice overexpressing DUSP6 compared to the control, n = 5-11 mice per group. (C) Hippocampal Sst mRNA levels in 5xFAD or WT mice overexpressing DUSP6 compared to the control, n = 6-11 mice per group. (D) Hippocampal Scg2 mRNA levels in 5xFAD or WT mice overexpressing DUSP6 compared to control, n = 6-11 mice per group. (E) Hippocampal Dusp4 mRNA levels in 5xFAD or WT overexpressing DUSP6 or GFP were assayed by RT-PCR, n = 5-11 mice per group. Statistical analyses were performed using a One-Way ANOVA followed by a Tukey’s post-hoc test, *p<0.05, **p<0.01, ***p< 0.001, ****p<0.0001; ns nonsignificant.

Journal: bioRxiv

Article Title: Dual-specificity protein phosphatase 6 (DUSP6) overexpression reduces amyloid load and improves memory deficits in male 5xFAD mice

doi: 10.1101/2023.08.24.554335

Figure Lengend Snippet: The effects of DUSP6 overexpression on VGF network-associated genes in 5xFAD and WT mice. (A) Hippocampal Vgf mRNA levels in 5xFAD or WT mice overexpressing DUSP6 compared to control (WT-GFP), n = 5-11 mice per group. (B) Hippocampal Bdnf mRNA levels in 5xFAD or WT mice overexpressing DUSP6 compared to the control, n = 5-11 mice per group. (C) Hippocampal Sst mRNA levels in 5xFAD or WT mice overexpressing DUSP6 compared to the control, n = 6-11 mice per group. (D) Hippocampal Scg2 mRNA levels in 5xFAD or WT mice overexpressing DUSP6 compared to control, n = 6-11 mice per group. (E) Hippocampal Dusp4 mRNA levels in 5xFAD or WT overexpressing DUSP6 or GFP were assayed by RT-PCR, n = 5-11 mice per group. Statistical analyses were performed using a One-Way ANOVA followed by a Tukey’s post-hoc test, *p<0.05, **p<0.01, ***p< 0.001, ****p<0.0001; ns nonsignificant.

Article Snippet: AAV5-GFP (control), and AAV5-DUSP6 (VectorBuilder Inc., Chicago, IL; AAV-5’ITR-CAG-mDUSP6-WPRE-BGHpA-3’ITR) (AAV5 serotype/AAV2 genotype) were prepared by the Vector Core at the University of North Carolina at Chapel Hill.

Techniques: Over Expression, Reverse Transcription Polymerase Chain Reaction

DUSP6 overexpression downregulates differentially expressed genes (DEGs) in female 5xFAD. (A, B) Volcano plot representation of female 5xFAD-GFP vs WT-GFP (A) and female 5xFAD-DUSP6 vs 5xFAD-GFP (B), n = 5 mice per group, threshold for DEGs represented is FDR < 0.05 (orange and blue dots). (C) Volcano plot representation of DEGs from male 5xFAD-GFP vs WT-GFP showed three DEGs. (D) Volcano plot representation of DEGs from male 5xFAD-DUSP6 vs WT-GFP showed five DEGs. (E, F) Enrichment analysis of DEGs from female 5xFAD GFP vs WT-GFP (E) and female 5xFAD-DUSP6 vs 5xFAD-GFP (F). (G) DEGs from (A) and (B) are also involved in ERK/MAPK, interferon, neuroinflammation and PD-1/PD-L1 pathways predicted by IPA analysis.

Journal: bioRxiv

Article Title: Dual-specificity protein phosphatase 6 (DUSP6) overexpression reduces amyloid load and improves memory deficits in male 5xFAD mice

doi: 10.1101/2023.08.24.554335

Figure Lengend Snippet: DUSP6 overexpression downregulates differentially expressed genes (DEGs) in female 5xFAD. (A, B) Volcano plot representation of female 5xFAD-GFP vs WT-GFP (A) and female 5xFAD-DUSP6 vs 5xFAD-GFP (B), n = 5 mice per group, threshold for DEGs represented is FDR < 0.05 (orange and blue dots). (C) Volcano plot representation of DEGs from male 5xFAD-GFP vs WT-GFP showed three DEGs. (D) Volcano plot representation of DEGs from male 5xFAD-DUSP6 vs WT-GFP showed five DEGs. (E, F) Enrichment analysis of DEGs from female 5xFAD GFP vs WT-GFP (E) and female 5xFAD-DUSP6 vs 5xFAD-GFP (F). (G) DEGs from (A) and (B) are also involved in ERK/MAPK, interferon, neuroinflammation and PD-1/PD-L1 pathways predicted by IPA analysis.

Article Snippet: AAV5-GFP (control), and AAV5-DUSP6 (VectorBuilder Inc., Chicago, IL; AAV-5’ITR-CAG-mDUSP6-WPRE-BGHpA-3’ITR) (AAV5 serotype/AAV2 genotype) were prepared by the Vector Core at the University of North Carolina at Chapel Hill.

Techniques: Over Expression

DUSP6 overexpression ameliorates microglial activation in female and male 5xFAD mice. (A, B) RT-qPCR results showed a significant decrease of Iba1 and Cd68 mRNAs in DUSP6-overexpressing female (A) and male (B) 5xFAD mice compared to GFP-overexpressing 5xFAD mice, n = 4-7 mice/group. (C, D) Representative images of microglial cells from female (C) and male (D) dorsal hippocampi labeled with anti-IBA1 (red). Scale bar = 50 µm. (E) Quantification of IBA1 fluorescence intensity from images in C showed that DUSP6 overexpression decreased IBA1 levels in female 5xFAD, n = 5-6 mice/group. (F) Quantification of IBA1 fluorescence intensity from images in D showed that DUSP6 overexpression reduced IBA1 levels in male 5xFAD mice, n = 4-7 mice/group. Statistical analyses were performed using a one-way ANOVA followed by a Tukey’s post-hoc test for all graphs, *p<0.05, **p<0.001, ****p<0.0001; ns nonsignificant.

Journal: bioRxiv

Article Title: Dual-specificity protein phosphatase 6 (DUSP6) overexpression reduces amyloid load and improves memory deficits in male 5xFAD mice

doi: 10.1101/2023.08.24.554335

Figure Lengend Snippet: DUSP6 overexpression ameliorates microglial activation in female and male 5xFAD mice. (A, B) RT-qPCR results showed a significant decrease of Iba1 and Cd68 mRNAs in DUSP6-overexpressing female (A) and male (B) 5xFAD mice compared to GFP-overexpressing 5xFAD mice, n = 4-7 mice/group. (C, D) Representative images of microglial cells from female (C) and male (D) dorsal hippocampi labeled with anti-IBA1 (red). Scale bar = 50 µm. (E) Quantification of IBA1 fluorescence intensity from images in C showed that DUSP6 overexpression decreased IBA1 levels in female 5xFAD, n = 5-6 mice/group. (F) Quantification of IBA1 fluorescence intensity from images in D showed that DUSP6 overexpression reduced IBA1 levels in male 5xFAD mice, n = 4-7 mice/group. Statistical analyses were performed using a one-way ANOVA followed by a Tukey’s post-hoc test for all graphs, *p<0.05, **p<0.001, ****p<0.0001; ns nonsignificant.

Article Snippet: AAV5-GFP (control), and AAV5-DUSP6 (VectorBuilder Inc., Chicago, IL; AAV-5’ITR-CAG-mDUSP6-WPRE-BGHpA-3’ITR) (AAV5 serotype/AAV2 genotype) were prepared by the Vector Core at the University of North Carolina at Chapel Hill.

Techniques: Over Expression, Activation Assay, Quantitative RT-PCR, Labeling, Fluorescence

Pathway analysis comparison of female and male 5xFAD mice overexpressing DUSP4 or DUSP6 using DEGs (p < 0.05). (A) Venn diagram showed the shared common DEGs (p < 0.05) in female and male 5xFAD overexpressing DUSP4 or DUSP6. (B) Pathway enrichment analysis of the same DEGs (p < 0.05) by Enrichr.

Journal: bioRxiv

Article Title: Dual-specificity protein phosphatase 6 (DUSP6) overexpression reduces amyloid load and improves memory deficits in male 5xFAD mice

doi: 10.1101/2023.08.24.554335

Figure Lengend Snippet: Pathway analysis comparison of female and male 5xFAD mice overexpressing DUSP4 or DUSP6 using DEGs (p < 0.05). (A) Venn diagram showed the shared common DEGs (p < 0.05) in female and male 5xFAD overexpressing DUSP4 or DUSP6. (B) Pathway enrichment analysis of the same DEGs (p < 0.05) by Enrichr.

Article Snippet: AAV5-GFP (control), and AAV5-DUSP6 (VectorBuilder Inc., Chicago, IL; AAV-5’ITR-CAG-mDUSP6-WPRE-BGHpA-3’ITR) (AAV5 serotype/AAV2 genotype) were prepared by the Vector Core at the University of North Carolina at Chapel Hill.

Techniques: Comparison

Gene ontology (GO) enrichment analysis of DEGs (p < 0.05) of female and male 5xFAD mice overexpressing DUSP4 or DUSP6. (A) Synaptic gene ontologies (SynGO) analysis of DEGs (p < 0.05) from female and male 5xFAD mice overexpressing DUSP4 or DUSP6 by Enrichr. (B) Venn diagram showed the common DEGs between female and male 5xFAD overexpressing DUSP4 or DUSP6. (C) GO enrichment analysis of DEGs from female and male 5xFAFD overexpressing DUSP4 or DUSP6 compared to the Mouse Genome Informatics (MGI) database by Enrichr.

Journal: bioRxiv

Article Title: Dual-specificity protein phosphatase 6 (DUSP6) overexpression reduces amyloid load and improves memory deficits in male 5xFAD mice

doi: 10.1101/2023.08.24.554335

Figure Lengend Snippet: Gene ontology (GO) enrichment analysis of DEGs (p < 0.05) of female and male 5xFAD mice overexpressing DUSP4 or DUSP6. (A) Synaptic gene ontologies (SynGO) analysis of DEGs (p < 0.05) from female and male 5xFAD mice overexpressing DUSP4 or DUSP6 by Enrichr. (B) Venn diagram showed the common DEGs between female and male 5xFAD overexpressing DUSP4 or DUSP6. (C) GO enrichment analysis of DEGs from female and male 5xFAFD overexpressing DUSP4 or DUSP6 compared to the Mouse Genome Informatics (MGI) database by Enrichr.

Article Snippet: AAV5-GFP (control), and AAV5-DUSP6 (VectorBuilder Inc., Chicago, IL; AAV-5’ITR-CAG-mDUSP6-WPRE-BGHpA-3’ITR) (AAV5 serotype/AAV2 genotype) were prepared by the Vector Core at the University of North Carolina at Chapel Hill.

Techniques: